AI Summary & Key Takeaways
AI InsightBu durum, implant yaşam süresini tehlikeye atabilecek bir sorun olarak düşünülmelidir
📌 3 Key Takeaways
Abstract
Amaç: Zirkonya üstyapılar estetik ve biyouyumluluk gibi üstün özellikleriyle tanımlanır, ancak mikrosızıntı halen tanımsızdır. Bu çalışmanın amacı gerçek zamanlı PZR kullanarak iki farklı implant-abutment birleşimindeki mikrosızıntıyı nicel olarak incelemektir. Gereç ve Yöntem: Mikropipet kullanarak 3 mikrolitre Fuzobakterium Nukleatum standardı implantın iç kompartımanına yerleştirildi. İnternal hex geometrisine sahip 2 farklı üstyapı (Zirkonya=7, Titanyum=7) implant üzerine sabitlendi. Kombinasyon 5 Ml tiyoglukolat içerisine daldırıldı. DNA çıkarımı için 0.2 ml sıvı örneği alındı. Bu süreçte protein K içerikli yüksek saflıktaki PCR hazırlık kiti kullanıldı. Analizler, F. Nucleatum primer spesifiği: F:CGCAGAAGGTGAAAGTCCTGTAT, R:TGGTCCTCACTGATTCACACAGA (101 bp) kullanılarak Lightcycler 480 cihazında yapıldı. Mann-Whitney U ve Friedman analizleri kullanılarak 2, 4 ve 8. günlerdeki Titanyum ve Zirkonya örnekler karşılaştırıldı. Bulgular: En yüksek Cq sayısı (DNA sayısı) Zirkonya grupta 8. gün sonunda gözlemlendi. Bunu 4. ve 2. günlerdeki Zirkonya gruplar takip etti. Tüm zaman aralıklarında implant-Zirkonya ara yüzündeki üreme İmplant-Titanyum ara yüzündekinden belirgin şekilde fazla oldu. (p<0.05). Sonuçlar: Çalışmanın sonuçlarına göre biyouyumlulukla ön palana çıksa da eşleşen yüzlerindeki uyumsuzluk nedeniyle Zirkonya üstyapılar daha fazla mikro sızıntı üretti. Bu durum, implant yaşam süresini tehlikeye atabilecek bir sorun olarak düşünülmelidir
Özet
Background and Aim: Zirconia superstructures are expressed to have better specifications like aesthetics and biocompatibility; however, the micro-leakage is still undefined. The aim of this study was to measure bacterial micro-leakage along two different implant-abutment interfaces with Realtime PCR quantitatively at in-vitro conditions. Materials and Methods: Three microliters of Fusobacterium Nucleatum standard density were inoculated into inner compartment of the implant’s fixtures using micropipette. Two different abutment types (zirconia=7, titanium=7) with internal-hex geometries were fixed onto their own fixture. The combinations were immersed in 5 ml of thioglycolate media. Media (0.2 ml) were taken from tubes for DNA extraction. High-Pure PCR Template Preparation Protocol with Proteinase K was used for the process. Real-time PCR analysis was performed with Lightcycler 480 system using F.nucleatum specific; F:CGCAGAAGGTGAAAGTCCTGTAT, R:TGGTCCTCACTGATTCACACAGA (101 bp) primer set. Mann- Whitney U test was used to compare 2nd, 4th and 8th day of corresponding Zirconia and Titanium groups. Results: The highest mean cq number (DNA quantification) was obtained at the day 8 of the zirconia group and followed by mean cq numbers obtained at the 4th and 2nd day of zirconia groups. The microorganism proliferations at implant-zirconia interface were significantly higher than corresponding implanttitanium interface at each time intervals (p<0.05). Conclusion: It was concluded that, zirconia abutment which is especially preferred for biocompatibility specialty may generate disharmony of mating surfaces resulting higher micro-leakage data at the interfaces. This may jeopardize the longevity of the implants and may be estimated as an issue